View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20114_low_16 (Length: 400)
Name: NF20114_low_16
Description: NF20114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20114_low_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 253; Significance: 1e-140; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 101 - 378
Target Start/End: Original strand, 36278795 - 36279074
Alignment:
| Q |
101 |
cattctcatactctggcctcaaatcaggaaccttgaagcaaaccaattttctggtcttgttccctctgaacttggagctctatttaacctgcagactttg |
200 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36278795 |
cattctcatattctggcctcaaatcaggaaccttgaagcaaaccaattttctggtcttgttccctctgaacttggagttctatttaacctgcagactttg |
36278894 |
T |
|
| Q |
201 |
taagaaaatgatatccaagattcacgtgctttattgctataag--tatgtagcacaaacacttcagtatctgacactgacacgataccgatacatgtggt |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
36278895 |
taagaaaatgatatccaagattcacgtgctttattgctataagtatatgtagcacaaacacttcagtatttgacactgacacgataccggtacatgtggt |
36278994 |
T |
|
| Q |
299 |
tatatacaatcactttcattttcataatttgttaatagtgtttaaatatcagcgtcgtgtctggtgtccgactgtctgtg |
378 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36278995 |
tatatacaatcactttcattttcataatttgttaatagtgtttaaatatcagcgtcgtgtctggtgtccgactgtctgtg |
36279074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University