View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20114_low_18 (Length: 389)
Name: NF20114_low_18
Description: NF20114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20114_low_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 360; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 360; E-Value: 0
Query Start/End: Original strand, 11 - 374
Target Start/End: Complemental strand, 32379425 - 32379062
Alignment:
| Q |
11 |
cagagagctacggattgcaggttgcacttatggctggaatcccagaaaaaactgtgaacgttgcttcaaaggcaagccagcagatgaaaatatcaattgg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32379425 |
cagagagctacggattgcaggttgcacttatggctggaatcccagaaaaaactgtgaacgttgcttcaaaggcaagccagcagatgaaaatatcaattgg |
32379326 |
T |
 |
| Q |
111 |
caaaaactttaggtcaagtgaacagagatcagagttttcatctcttcacgaagaatggctgaagaccttgatgtctatcgcaagaatagaggatgctgaa |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32379325 |
caaaaactttaggtcaagtgaacagagatcagagttttcatctcttcacgaagaatggctgaagaccttgatgtctatcgcaagaatagaggatgttgaa |
32379226 |
T |
 |
| Q |
211 |
tcttttgatgatgatgttttagatacattagtctgtttgcggtatgaactaaagtcttcgtttaaatcaggtaactagagatgtagagtgcagcaggtag |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32379225 |
tcttttgatgatgatgttttagatacattagtctgtttgcggtatgaactaaagtcttcgtttaaatcaggtaactagagatgtagagtgcagcaggtag |
32379126 |
T |
 |
| Q |
311 |
ggctactaatcttacttctacaaaactgcttgtaaatttttacttatttccttagtgattaaag |
374 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32379125 |
ggctactaatcttacttctacaaaactgcttgtaaatttttacttatttccttagtgattaaag |
32379062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University