View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20114_low_19 (Length: 386)
Name: NF20114_low_19
Description: NF20114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20114_low_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 3e-70; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 22 - 168
Target Start/End: Original strand, 8931506 - 8931652
Alignment:
| Q |
22 |
aaagatgcagaattcaaacccttactatcatgatcatgaccattttcagcaccaccaacatcaaaaggtgtagactttgtagaatccaaacccttatgat |
121 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |
|
|
| T |
8931506 |
aaagatgcagaaatcaaacccttactatcatgatcatgaccattttcagcaccaccaacatcaaaaggtgtagactttgtagaatccaaaccgttatcat |
8931605 |
T |
|
| Q |
122 |
catgatcatgactattttcaacagaattcaacaaattagaaacaaaa |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8931606 |
catgatcatgactattttcaacagaattcaacaaattagaaacaaaa |
8931652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 251 - 368
Target Start/End: Original strand, 8931735 - 8931852
Alignment:
| Q |
251 |
caacactctcactgctctccacaaaacccccaaatctctcccccaattcagcacctctgaaatcaacatcaccaacactcacactcctctcaattttctc |
350 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
8931735 |
caacactctcactcctctccacaaaaccctcaaatctctcctccaattcagcacctctgaaatcaacatcaccaacactcccactcctctcaattttctc |
8931834 |
T |
|
| Q |
351 |
accaaattcactcaaaac |
368 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
8931835 |
accaaattcactcaaaac |
8931852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University