View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20114_low_21 (Length: 365)
Name: NF20114_low_21
Description: NF20114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20114_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 13 - 349
Target Start/End: Original strand, 9717087 - 9717417
Alignment:
| Q |
13 |
aatatgtctattgcaatctattgattcatatgaacggatctttacatagcacaaaaatttactatcaggcagcttaatatagatggaggacatggcacaa |
112 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||||||||||||||| |||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
9717087 |
aatatgtctattgcaatctattgatccatatgaagagatctttacatagcacaagaatttactatcatgcagcttaata--gatggaggacatggcacaa |
9717184 |
T |
|
| Q |
113 |
tgtcacatgcttggtttcactctagcgnnnnnnnnttcggcttacatagtatctatcttatcaatatttattctctatagtgtgtttatatgaagaaaga |
212 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9717185 |
tgtcacatgcttggtttcactctagcgaaaaaaaattcggcttacaaagtatct----tatcaatatttattctctatagtgtgtttatatgaagaaaga |
9717280 |
T |
|
| Q |
213 |
ccaacatatgataaagttggtgtcaaagataaatgttcnnnnnnncatatttctatggtggtttaagatcgcgagtattgttgattctagttgaaatatc |
312 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9717281 |
ccaacatatgataaagttggtgttaaagataaatgttcaaaaaagcatatttctatggtggtttaagatcgcgagtattgttgattttagttgaaatatc |
9717380 |
T |
|
| Q |
313 |
gtaccagcgtcttgataataatttgagggtgggggtg |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9717381 |
gtaccagcgtcttgattataatttgagggtgggggtg |
9717417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University