View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20114_low_23 (Length: 341)
Name: NF20114_low_23
Description: NF20114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20114_low_23 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 16 - 326
Target Start/End: Complemental strand, 35170136 - 35169829
Alignment:
| Q |
16 |
atttaacaacagaggcaacaattttggtgagatgtgggagtataagagattcataaactgtggcgagtgaggcgatgagtttgagagattgttttctgat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
35170136 |
atttaacaacagaggcaacaattttggtgagatgtgggagtataagagattcataaactgtggcgagtgaagcgatgagtttgagagattgttttctgat |
35170037 |
T |
 |
| Q |
116 |
ggaaggttttagttcggagtgaatgtcgagaatgcaagagaggaatggggagatggaatgtggagttaatgagtggaggattgtttcgagctctttggtt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35170036 |
ggaaggttttagttcggagtgaatgtcgagaatgcaagagaggaatggggagatggaatgtggagttaatgagtggaggattgtttcgagctctttggtt |
35169937 |
T |
 |
| Q |
216 |
ccgatatcgtgtgtgtctcgatctccaactttgtttaatgcattgtgtactctttgcttcatctcgaaattactactactcagcttgttgttggtcttca |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35169936 |
ccgatatcgtgtgtgtctcgatctccaactttgtttaatgcattgtgtactctttgcttcatctcgaaattac---tactcagcttgttgttggtcttca |
35169840 |
T |
 |
| Q |
316 |
ttgttattgct |
326 |
Q |
| |
|
||||||||||| |
|
|
| T |
35169839 |
ttgttattgct |
35169829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University