View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20114_low_27 (Length: 292)
Name: NF20114_low_27
Description: NF20114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20114_low_27 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 10 - 292
Target Start/End: Original strand, 8584847 - 8585129
Alignment:
| Q |
10 |
catcatcattttgggttttgatttccacattggttccgttcgcgatgagcttgatgtcttcgtttgtctctggaatatcacgtcgttgaagcaacttcaa |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
8584847 |
catcatcattttgtgttttgatttccacattggttccgttcgcaatgaacttgatgtcttcgtttgtctctggaatatcacgtcgttgaagcaacttcca |
8584946 |
T |
 |
| Q |
110 |
ctctcttgcctttgtttcttccaattctttctttgtttgctcaagttctttcttgagggatttgatgcattgtgctaagaagttagcttcttcttttgat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8584947 |
ctctcttgcctttgtttcttccaattctttctttgtttgctcaagttctttcttgagggatttgatgcattgtgctaagaagttagcttcttcttttgat |
8585046 |
T |
 |
| Q |
210 |
ccttcaagtttttgctttgtttcttctagctcagctgctaatgctccagctttggattgtgcatgaccagtctcgcttgcttc |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8585047 |
ccttcaagtttttgctttgtttcttctagctcagctgctaatgctccagctttggattgtgcatgaccagtctcgcttgcttc |
8585129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University