View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20114_low_34 (Length: 253)
Name: NF20114_low_34
Description: NF20114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20114_low_34 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 40854832 - 40855071
Alignment:
| Q |
1 |
tttgagctattttattgctttagt-gatgttttcttttatttttagttacatgctgagtgccttgtttatcaattgccgaattacggagattctgttatt |
99 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40854832 |
tttgagctattttattgctttagttgatgtcttcttttatttttagttacatgctgagtgccttgtttatcaattgccgaattacggagattctgttatt |
40854931 |
T |
|
| Q |
100 |
ccgtttgtacactatttctatttgaattgcatgatgctttgttaagctgttcaaccactaatgtctaagttagaagaaacttggtaaataggaat--cac |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
40854932 |
ccgtttgtacactatttctatttgaattgcatgatgctttgttaagctgttcaaccactaatgtctaagttagaagaaacttggtaaataggaatcacac |
40855031 |
T |
|
| Q |
198 |
cattctgatgttttaagggagttgtacatcctctaatatt |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40855032 |
cattctgatgttttaagggagttgtacatcctctaatatt |
40855071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University