View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20114_low_43 (Length: 202)

Name: NF20114_low_43
Description: NF20114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20114_low_43
NF20114_low_43
[»] chr4 (1 HSPs)
chr4 (1-187)||(45283737-45283914)


Alignment Details
Target: chr4 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 45283737 - 45283914
Alignment:
1 tataccgtctactaatcataaattaccgtctatatgagtttttnnnnnnngatagatagatatgtttaaagtcaaatatggggttagtgatttagaggtt 100  Q
    |||||||||||||||||||||||||||||  ||||||||||||       ||||||||||||| |||||||||||||||||  |||||||||||||||||    
45283737 tataccgtctactaatcataaattaccgt--atatgagtttttaa-----gatagatagatatctttaaagtcaaatatgg--ttagtgatttagaggtt 45283827  T
101 gtacaaaatgtgcattaaatcaatgtatatgtttccagattataagctggagattttggggttttgactttcttgagactctctctg 187  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
45283828 gtacaaaatgtgcattaaatcaatgtatatgtttccagattataagctggcgattttggggttttgactttcttgagactctctctg 45283914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University