View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20115_high_13 (Length: 262)

Name: NF20115_high_13
Description: NF20115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20115_high_13
NF20115_high_13
[»] chr4 (1 HSPs)
chr4 (18-222)||(40292390-40292594)


Alignment Details
Target: chr4 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 18 - 222
Target Start/End: Original strand, 40292390 - 40292594
Alignment:
18 agaattagcacatatcattgatataaggtgcgttatgggatattatgttgattgatgataaattttagaaaaggctttataaaaatcgcaccattttatt 117  Q
    |||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
40292390 agaattagcacatatcattgatataaggtgtgttatgggatgttatgttgattgatgataaattctagaaaaggctttataaaaatcgcaccattttatt 40292489  T
118 tcgtcttgtttttcagcaagtagaaatttttagagtgttttgtttcaagtgaagcatacnnnnnnnnngtggtgtatgaaaaattcttatggcagtttat 217  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||         ||||||||||||||||||||||||||||||||    
40292490 tcgtcttgtttttcaacaagtagaaatttttagagtgttttgtttcaagtgaagcatacttttttttggtggtgtatgaaaaattcttatggcagtttat 40292589  T
218 atata 222  Q
    |||||    
40292590 atata 40292594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University