View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20115_high_14 (Length: 244)
Name: NF20115_high_14
Description: NF20115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20115_high_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 16 - 188
Target Start/End: Original strand, 33217182 - 33217353
Alignment:
| Q |
16 |
atgcgctcttagtagttttttgttattaatattatatcatgttttacttgtctaaatattataccactttcattgttgatttactgtccctagatttttc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
33217182 |
atgcgctcttagtagttttttgttattaatattatatcatgttttacttgtctaaatattttaccactat-attgttgatttactgtccctagatttttc |
33217280 |
T |
 |
| Q |
116 |
taatatttgtgtgtgctaataaagtgttgaaaagcaagaagaaaatgagatgattgagagcaagattagatga |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33217281 |
taatatttgtgtgtgctaataaagtgttgaaaagcaagaagaaaatgagatgattgagagcaagattagatga |
33217353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University