View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20115_high_18 (Length: 237)
Name: NF20115_high_18
Description: NF20115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20115_high_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 159 - 222
Target Start/End: Complemental strand, 6286747 - 6286681
Alignment:
| Q |
159 |
aataggaatggacaaaaaccag---tgaagaatcaatattgtaacaactaccagagagagaataatc |
222 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6286747 |
aatagaaatggacaaaaaccagcagtgaagaatcaatattgtaacaactaccatagagagaataatc |
6286681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University