View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20115_low_10 (Length: 298)
Name: NF20115_low_10
Description: NF20115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20115_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 279
Target Start/End: Original strand, 2127252 - 2127529
Alignment:
| Q |
1 |
catgacataattcacattcctccacatgttaggnnnnnnnttgtttgttagcttggaatagtaatttactagcagggattatttagataagataaaatta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2127252 |
catgacataattcacattcctccacatgttaggaaaaaa-ttgtttgttagcttggaatagtaatttactagcagggattatttagataagataaaatta |
2127350 |
T |
 |
| Q |
101 |
ataagggaattccagagtaagcaggtaattttgaatggttagcattgagaaatgatcattttctcaattgtagataggaaaacacttatgacatatttag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | |
|
|
| T |
2127351 |
ataagggaattccagagtaagcaggtaattttgaatggttagcattgagaaatgatcattttctcaattgtagatagggaaacacttatgacatatttgg |
2127450 |
T |
 |
| Q |
201 |
atcaacttatttgagnnnnnnnacaagtataaacaattgtgagagattgtttggaaaagcttatagaaacagcttttga |
279 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2127451 |
atcaacttatttgagtttttttacaagtataaacaattgtgagagattgtttggaaaagcttatagaaacagcttttga |
2127529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University