View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20115_low_16 (Length: 262)
Name: NF20115_low_16
Description: NF20115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20115_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 18 - 222
Target Start/End: Original strand, 40292390 - 40292594
Alignment:
| Q |
18 |
agaattagcacatatcattgatataaggtgcgttatgggatattatgttgattgatgataaattttagaaaaggctttataaaaatcgcaccattttatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40292390 |
agaattagcacatatcattgatataaggtgtgttatgggatgttatgttgattgatgataaattctagaaaaggctttataaaaatcgcaccattttatt |
40292489 |
T |
 |
| Q |
118 |
tcgtcttgtttttcagcaagtagaaatttttagagtgttttgtttcaagtgaagcatacnnnnnnnnngtggtgtatgaaaaattcttatggcagtttat |
217 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40292490 |
tcgtcttgtttttcaacaagtagaaatttttagagtgttttgtttcaagtgaagcatacttttttttggtggtgtatgaaaaattcttatggcagtttat |
40292589 |
T |
 |
| Q |
218 |
atata |
222 |
Q |
| |
|
||||| |
|
|
| T |
40292590 |
atata |
40292594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University