View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20115_low_18 (Length: 241)
Name: NF20115_low_18
Description: NF20115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20115_low_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 11 - 224
Target Start/End: Original strand, 6170687 - 6170900
Alignment:
| Q |
11 |
gtgagatgaaggagactaagctcaagcaaataatcaatttaatgtgacatctttttaatttttaaaatgcaagacacgggttgtggcaaattgaactttg |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6170687 |
gtgaaatgaaggagactaagctcaagcaaataatcaatttaatgtgacatctttttaatttttaaaatgcaagacacgggttgtggcaaattgaactttg |
6170786 |
T |
 |
| Q |
111 |
tagacacaaaaaatgactataaaggtggggtggttcaatcaaaaacttcggtggaaatttgtcattagccaagtgagtagatcatatgcannnnnnnaat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
6170787 |
tagacacaaaaaatgactataaaggtggggtggttcaatcaaaaacttcggtggaaatttgtcattagccaagtgagtagatcatatgcatttttttaat |
6170886 |
T |
 |
| Q |
211 |
tataaacaaaatat |
224 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
6170887 |
tataaacaaaatat |
6170900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University