View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20116_high_49 (Length: 292)
Name: NF20116_high_49
Description: NF20116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20116_high_49 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 11 - 274
Target Start/End: Complemental strand, 33483248 - 33482985
Alignment:
| Q |
11 |
cacagatccacagccattgagtaatgggtagcccccaaaaggacttcaggtgctctataccacagggttagtatctgaaaatgacacaaaagtaatgcaa |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33483248 |
cacatatccacagccattgagtaatgggtagcccccaaaaggacttcaggtgctctataccacagggttagtatctgaaaatgacacaaacgtaatgcaa |
33483149 |
T |
 |
| Q |
111 |
tcagccacaattgtggatcatgacaccctgaatgcaaaaccaacaagggggcaaaatctaaaaatatatctctctttaacatcaacattgtcacaaccca |
210 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | |
|
|
| T |
33483148 |
tcagccacaagtgaggatcatgacaccctgaatgcaaaaccaacaagggggcaaaatctaaaaatctatctctctttaacatcaacattgtcacaaccta |
33483049 |
T |
 |
| Q |
211 |
atcacagaccataatataggcataggctaatttcaactcaacttatatgtagcttaacaatcct |
274 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33483048 |
atcacagacaataacctaggcataggctaatttcaactcaacttatatgtagcttaacaatcct |
33482985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University