View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20116_high_52 (Length: 283)
Name: NF20116_high_52
Description: NF20116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20116_high_52 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 77; Significance: 9e-36; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 17914052 - 17913944
Alignment:
| Q |
1 |
ctgaggagacatggcggagggattaactaggagaagggagaatttgctatgaagaagagagtaagagagaagcgcgaataaggaaggtatatatatgatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
17914052 |
ctgaggagacatggcggagggattaactaggagaagggagaatttgctat---gacgagagtaagagagaagcgcgaacaaggaagg----tatatgatt |
17913960 |
T |
 |
| Q |
101 |
agggttttcaaagttt |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
17913959 |
agggttttcaaagttt |
17913944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 128 - 164
Target Start/End: Complemental strand, 17912956 - 17912920
Alignment:
| Q |
128 |
ataagtttgtttttcttgtttcttttcgctcatatat |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17912956 |
ataagtttgtttttcttgtttcttttcgctcatatat |
17912920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 228 - 264
Target Start/End: Complemental strand, 17910460 - 17910424
Alignment:
| Q |
228 |
cttgggaagccttttcattcaaatcatgacacacttg |
264 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
17910460 |
cttgggaagccttttcattcaaatcataacacacttg |
17910424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University