View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20116_high_52 (Length: 283)

Name: NF20116_high_52
Description: NF20116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20116_high_52
NF20116_high_52
[»] chr5 (3 HSPs)
chr5 (1-116)||(17913944-17914052)
chr5 (128-164)||(17912920-17912956)
chr5 (228-264)||(17910424-17910460)


Alignment Details
Target: chr5 (Bit Score: 77; Significance: 9e-36; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 17914052 - 17913944
Alignment:
1 ctgaggagacatggcggagggattaactaggagaagggagaatttgctatgaagaagagagtaagagagaagcgcgaataaggaaggtatatatatgatt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||   || |||||||||||||||||||||| ||||||||    |||||||||    
17914052 ctgaggagacatggcggagggattaactaggagaagggagaatttgctat---gacgagagtaagagagaagcgcgaacaaggaagg----tatatgatt 17913960  T
101 agggttttcaaagttt 116  Q
    ||||||||||||||||    
17913959 agggttttcaaagttt 17913944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 128 - 164
Target Start/End: Complemental strand, 17912956 - 17912920
Alignment:
128 ataagtttgtttttcttgtttcttttcgctcatatat 164  Q
    |||||||||||||||||||||||||||||||||||||    
17912956 ataagtttgtttttcttgtttcttttcgctcatatat 17912920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 228 - 264
Target Start/End: Complemental strand, 17910460 - 17910424
Alignment:
228 cttgggaagccttttcattcaaatcatgacacacttg 264  Q
    ||||||||||||||||||||||||||| |||||||||    
17910460 cttgggaagccttttcattcaaatcataacacacttg 17910424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University