View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20116_high_57 (Length: 275)
Name: NF20116_high_57
Description: NF20116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20116_high_57 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 42244372 - 42244150
Alignment:
| Q |
1 |
caaggtacgtgctctaaagcttgaactnnnnnnngctctacatcaattttcaaaacgtcactcctcataacaaaacgattattatacaacttatgatgat |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42244372 |
caaggtacgtgctctaaagcttgaactaaaaaaagctctacatcaattttcaaaacgtcactcctcataacaaaacgattattatacagcttatgatgat |
42244273 |
T |
|
| Q |
101 |
atcatttgaaactgtagacttgagtatacagtgttgactcgctcggggcatgggtgggaagacctacgggctacaacttattaacgatactttgattgct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42244272 |
atcatttgaaactgtagacttgagtatagagtgttgactcgctcggagcatgggtgggaagacctacgggctacaacttattaacgatactttgattgct |
42244173 |
T |
|
| Q |
201 |
atgcaaaacttgattgttattga |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
42244172 |
atgcaaaacttgattgttattga |
42244150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 228 - 270
Target Start/End: Complemental strand, 42241691 - 42241649
Alignment:
| Q |
228 |
cggccctaagtccccatgtcatattttggaatacaccctaact |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42241691 |
cggccctaagtccccatgtcatattttggagtacaccctaact |
42241649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University