View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20116_high_67 (Length: 254)
Name: NF20116_high_67
Description: NF20116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20116_high_67 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 36962878 - 36963113
Alignment:
| Q |
1 |
ttatcgtgtataaacggctactgaaaagacatctaatactgaaacagttgttgatgaaatattttttcaactataagtgaattcaggtcaagcagatttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36962878 |
ttatcgtgtataaacggctactgaaaagacatctaatactgaaacagttgttgatgaaacattttttcaactataagtgaattcaggtcaagcagatttt |
36962977 |
T |
 |
| Q |
101 |
actcacagaacaaaactctggagattgtcccttgatttggttctgaattttgattaatttcgggagtttgtaaccgatatctagctatctttggttcagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36962978 |
actcacagaacaaaactctggagattgtcccttgatttggttctgaattttgattaatttcgggagtttgtaaccgatatctagctatctttggttcagt |
36963077 |
T |
 |
| Q |
201 |
cagtgcaacttaatctccgaccacttcatcacatta |
236 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36963078 |
cagtgcaacttaatctccgaccactttatcacatta |
36963113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University