View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20116_high_76 (Length: 236)

Name: NF20116_high_76
Description: NF20116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20116_high_76
NF20116_high_76
[»] chr4 (2 HSPs)
chr4 (54-227)||(55695107-55695280)
chr4 (1-122)||(55695284-55695405)


Alignment Details
Target: chr4 (Bit Score: 146; Significance: 5e-77; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 54 - 227
Target Start/End: Complemental strand, 55695280 - 55695107
Alignment:
54 tgctgattctgtttcagtagtttctttagcctcttcagctgatacttcctctttcacttcgaccttttcaggttccgcgttctctacctctggcttggct 153  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||    
55695280 tgctgattctgtttcagtagtttctttagcctcttcagctgatacttcctctttcacttcgactttttcaggttccgggttctctacctctggcttggct 55695181  T
154 tcctcagttacttgtgtactctcagcttcaactggaacttcagtttctcctttctccactgctactacttcttc 227  Q
    ||||  |||||||||||||||||||||||||| ||||||||||||||| | |||||||||||||||||||||||    
55695180 tcctgggttacttgtgtactctcagcttcaacgggaacttcagtttcttcattctccactgctactacttcttc 55695107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 122
Target Start/End: Complemental strand, 55695405 - 55695284
Alignment:
1 atcactttttatgcttctgtggtggttacttcttccactggtactgctatggctgctgattctgtttcagtagtttctttagcctcttcagctgatactt 100  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||||||||||||| ||||||||    
55695405 atcactttttatgcttctgtggtggttacttcttccactggtgctgctattgctgctgattctatttcagtagtttctttagcctcttcagttgatactt 55695306  T
101 cctctttcacttcgaccttttc 122  Q
    |||||||  ||||||| |||||    
55695305 cctcttttgcttcgactttttc 55695284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University