View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20116_high_80 (Length: 228)

Name: NF20116_high_80
Description: NF20116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20116_high_80
NF20116_high_80
[»] chr1 (1 HSPs)
chr1 (15-167)||(6966578-6966730)


Alignment Details
Target: chr1 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 15 - 167
Target Start/End: Original strand, 6966578 - 6966730
Alignment:
15 cataatcaaaacaacattagtaatttttctgaaaaataaataaaccacaatatacttgatgttggagcttatacccttgctcttgattctagcatcatat 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6966578 cataatcaaaacaacattagtaatttttctgaaaaataaataaaccacaatatacttgatgttggagcttatacccttgctcttgattctagcatcatat 6966677  T
115 gatgatctttgcagctttggggcctcatacatacttgcttgttacgttaaaat 167  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
6966678 gatgatctttgcagctttggggcctcatacatacttgcttgttacgttaaaat 6966730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University