View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20116_low_40 (Length: 343)
Name: NF20116_low_40
Description: NF20116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20116_low_40 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 15 - 228
Target Start/End: Original strand, 2628782 - 2628995
Alignment:
| Q |
15 |
aaatccaacaatactctattttgttaatcatgttattcttacgaagtatccatcgttgattagtactaagtactttaatagtaactaatcagtgtcagaa |
114 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2628782 |
aaatccaacaataatctattttgttaatcatgttattcttacgaagtatccatcgttgtttagtactaagtactttaatagtaactaatcagtgtcagaa |
2628881 |
T |
|
| Q |
115 |
aagaatcagaattcgaacccttgatgactctcttcctaactccttagtctcttatcactttttgttaaacccttatcatgcttctatgacttttcttcac |
214 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2628882 |
aagaatcagaattcgaacccttgatcactctcttcctaactccttagtctcttatcactttttgttaaacccttatcatgcttctatgacttttcttcac |
2628981 |
T |
|
| Q |
215 |
aaatgtcatgtcta |
228 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
2628982 |
aaatgtcatgtcta |
2628995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 257 - 335
Target Start/End: Original strand, 2628989 - 2629067
Alignment:
| Q |
257 |
atgtctatagacaaatttcaacccnnnnnnnnaaaggaaatctctaccctgttttccacaataattaccccaattctgt |
335 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2628989 |
atgtctatagacaaatttcaacccttttttttaaaggaaatctctaccctgttttccacaataattaccccaattctgt |
2629067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University