View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20116_low_56 (Length: 282)
Name: NF20116_low_56
Description: NF20116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20116_low_56 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 18 - 272
Target Start/End: Original strand, 42024678 - 42024933
Alignment:
| Q |
18 |
catacattcttggcagctgcgctgaaggcttccctgtgggttatatcaggattgacagacttaatgcgttggatctcgtccctgcagatggaccgtattt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42024678 |
catacattcttggcagctgcgctgaaggcttccctgtgggttatatcaggattgacagacttaatgcgttggatctcgtccctgcagatggaccgtattt |
42024777 |
T |
 |
| Q |
118 |
agatttacttcacacttttataacattaacaagaaaatttaatattatatatcagaaattgaatatgaagtt-nnnnnnnngtacaatggttttaaatga |
216 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42024778 |
agatttacttcacactttaataacattaacaagaaaatttaatattatatatcagaaattgaatatgaagttaaaaaaaaagtacaatggttttaaatga |
42024877 |
T |
 |
| Q |
217 |
ctatactcacttgatgaatcggttgtatgctgagggaactctctgtcttttctctg |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42024878 |
ctatactcacttgatgaatcggttgtatgctgagggaactctctgtcttttctctg |
42024933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University