View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20116_low_64 (Length: 270)
Name: NF20116_low_64
Description: NF20116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20116_low_64 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 6 - 221
Target Start/End: Complemental strand, 6587167 - 6586951
Alignment:
| Q |
6 |
gagagagatgaaaaggtgaaagttctaattccatgagttgatggggttaa-tatccttgatttgatagggacttgtgtggtgctttacttcattatatac |
104 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
6587167 |
gagagtgatgaaaaggtgaaagttctaattccatgagttgatggggttaaatatccttgatttgataggaacctgtgtggtgctttacttcattatatac |
6587068 |
T |
 |
| Q |
105 |
acatggctacttctacttgtgtgacaaagaatctaccataggcccatacagataagccgatcagtgccaaaagtgggaccacgagaattagagggggaaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6587067 |
acatggctacttctacttgtgtgacaaagaatctaccataggcccatacagataagccgatcagtgccaaaagtgggaccacgagaattagagggggaaa |
6586968 |
T |
 |
| Q |
205 |
atgggggaggaatgtga |
221 |
Q |
| |
|
||| ||||||||||||| |
|
|
| T |
6586967 |
atgagggaggaatgtga |
6586951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 224 - 252
Target Start/End: Complemental strand, 6586918 - 6586890
Alignment:
| Q |
224 |
tgattacgtgggtttcatggtgggtaaag |
252 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6586918 |
tgattacgtgggtttcatggtgggtaaag |
6586890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University