View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20116_low_64 (Length: 270)

Name: NF20116_low_64
Description: NF20116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20116_low_64
NF20116_low_64
[»] chr2 (2 HSPs)
chr2 (6-221)||(6586951-6587167)
chr2 (224-252)||(6586890-6586918)


Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 6 - 221
Target Start/End: Complemental strand, 6587167 - 6586951
Alignment:
6 gagagagatgaaaaggtgaaagttctaattccatgagttgatggggttaa-tatccttgatttgatagggacttgtgtggtgctttacttcattatatac 104  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || |||||||||||||||||||||||||||    
6587167 gagagtgatgaaaaggtgaaagttctaattccatgagttgatggggttaaatatccttgatttgataggaacctgtgtggtgctttacttcattatatac 6587068  T
105 acatggctacttctacttgtgtgacaaagaatctaccataggcccatacagataagccgatcagtgccaaaagtgggaccacgagaattagagggggaaa 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6587067 acatggctacttctacttgtgtgacaaagaatctaccataggcccatacagataagccgatcagtgccaaaagtgggaccacgagaattagagggggaaa 6586968  T
205 atgggggaggaatgtga 221  Q
    ||| |||||||||||||    
6586967 atgagggaggaatgtga 6586951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 224 - 252
Target Start/End: Complemental strand, 6586918 - 6586890
Alignment:
224 tgattacgtgggtttcatggtgggtaaag 252  Q
    |||||||||||||||||||||||||||||    
6586918 tgattacgtgggtttcatggtgggtaaag 6586890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University