View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20116_low_66 (Length: 261)

Name: NF20116_low_66
Description: NF20116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20116_low_66
NF20116_low_66
[»] chr1 (2 HSPs)
chr1 (28-146)||(16437037-16437155)
chr1 (203-244)||(16436939-16436980)
[»] chr2 (1 HSPs)
chr2 (28-90)||(39534181-39534244)


Alignment Details
Target: chr1 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 28 - 146
Target Start/End: Complemental strand, 16437155 - 16437037
Alignment:
28 aagacaggacaactatccgcttttttgtccatgcattagttggggacaactttttgtccaacggtctactgttctaaatttacgttttcatccttcggtt 127  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16437155 aagacaggacaactatccgcttttttgttcatgcattagttggggacaactttttgtccaacggtctactgttctaaatttacgttttcatccttcggtt 16437056  T
128 tctcgctgtatctctcgtg 146  Q
    |||||||||||||||||||    
16437055 tctcgctgtatctctcgtg 16437037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 203 - 244
Target Start/End: Complemental strand, 16436980 - 16436939
Alignment:
203 cttccagttattgtttgcttacttaatcttttgtctccattc 244  Q
    |||||||||||||||||||||||| |||||||||||||||||    
16436980 cttccagttattgtttgcttactttatcttttgtctccattc 16436939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 28 - 90
Target Start/End: Original strand, 39534181 - 39534244
Alignment:
28 aagacaggacaactatccgcttttttgtccatg-cattagttggggacaactttttgtccaacg 90  Q
    ||||| |||||| || |||||||||||||||   | ||||||||||||||||||||||||||||    
39534181 aagacgggacaagtagccgcttttttgtccaccactttagttggggacaactttttgtccaacg 39534244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University