View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20116_low_66 (Length: 261)
Name: NF20116_low_66
Description: NF20116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20116_low_66 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 28 - 146
Target Start/End: Complemental strand, 16437155 - 16437037
Alignment:
| Q |
28 |
aagacaggacaactatccgcttttttgtccatgcattagttggggacaactttttgtccaacggtctactgttctaaatttacgttttcatccttcggtt |
127 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16437155 |
aagacaggacaactatccgcttttttgttcatgcattagttggggacaactttttgtccaacggtctactgttctaaatttacgttttcatccttcggtt |
16437056 |
T |
 |
| Q |
128 |
tctcgctgtatctctcgtg |
146 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
16437055 |
tctcgctgtatctctcgtg |
16437037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 203 - 244
Target Start/End: Complemental strand, 16436980 - 16436939
Alignment:
| Q |
203 |
cttccagttattgtttgcttacttaatcttttgtctccattc |
244 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
16436980 |
cttccagttattgtttgcttactttatcttttgtctccattc |
16436939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 28 - 90
Target Start/End: Original strand, 39534181 - 39534244
Alignment:
| Q |
28 |
aagacaggacaactatccgcttttttgtccatg-cattagttggggacaactttttgtccaacg |
90 |
Q |
| |
|
||||| |||||| || ||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
39534181 |
aagacgggacaagtagccgcttttttgtccaccactttagttggggacaactttttgtccaacg |
39534244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University