View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20116_low_73 (Length: 250)
Name: NF20116_low_73
Description: NF20116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20116_low_73 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 12 - 232
Target Start/End: Complemental strand, 28107698 - 28107478
Alignment:
| Q |
12 |
attattctcaatgaggatttaaaattatattgcaaacatcttgaaacatatttacaacattttacctcttataatctttcccctnnnnnnncttattatt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28107698 |
attattctcaatgaggatttaaaattatattgcaaacatcttgaaacatatttacaacattttacctcttataatctttcccctaaagaaacttattatt |
28107599 |
T |
|
| Q |
112 |
ttgctggtcaatttctatttaaaaactaaaagtcgatagagaataatactaaatattttagttttattgacttctttcaagctatttannnnnnngttac |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28107598 |
ttgctggtcaatttctatttaaaaactaaaagtcgatagagaataatactaaatattttagttttattgacttctttcaagctatttatttttttgttac |
28107499 |
T |
|
| Q |
212 |
aaacttctttcaagctattta |
232 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
28107498 |
aaacttctttcaagctattta |
28107478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University