View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20116_low_77 (Length: 242)
Name: NF20116_low_77
Description: NF20116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20116_low_77 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 12 - 225
Target Start/End: Original strand, 29243282 - 29243495
Alignment:
| Q |
12 |
agagaggcctatatcgtcagagatggtgagacaacatgaaatctatttgggggctaaatttcagtcaatgagtcgaagaaacttgggtatagggttcact |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29243282 |
agagaggcctatatcgtcagagatggtgagacaacatgaaatctatttgggggctaaatttcagtcaatgagtcgaagaaacttgggtatagggttcact |
29243381 |
T |
 |
| Q |
112 |
cgcgttgaagaagtaattttaggttatttgtattattgtttttcaaaaatttggaagctgatttatattttaacgttcttttataaagtttgagtaaaaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29243382 |
cgcgttgaagaagtaattttaggttatttgtattattgtttttcaaaaatttggaagctgatttatattttaacgttcttttataaagtttgagtaaaaa |
29243481 |
T |
 |
| Q |
212 |
gatgattttggtta |
225 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
29243482 |
gatgattttggtta |
29243495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University