View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20116_low_78 (Length: 238)
Name: NF20116_low_78
Description: NF20116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20116_low_78 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 21 - 238
Target Start/End: Complemental strand, 21579501 - 21579281
Alignment:
| Q |
21 |
agaacctaaagaaactttatagttttagccatattctttcctctttgcatctgaaaaatagaatataatttgctct--ttataatttacaaagttcttac |
118 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21579501 |
agaacataaagaaacttcatagttttagccatattttttcctctttgcatctgaaaaatagaatataatttgctctctttataatttacaaagttcttac |
21579402 |
T |
 |
| Q |
119 |
tcttataaaattaattaaagagtctaaacatttatggaattttaaaacattagaatcattactagatacctctcgaggatatcagtgcattgtgtttatc |
218 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
21579401 |
tctcataaaattaattaaagagtctaaacatttatggaattttaaaacattagaatcattactagatacctctcgaggatatcagtgcattgtgtttgtc |
21579302 |
T |
 |
| Q |
219 |
cc-tttagcacacttaaatac |
238 |
Q |
| |
|
|| ||||||||||||| |||| |
|
|
| T |
21579301 |
ccttttagcacacttagatac |
21579281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 164 - 238
Target Start/End: Complemental strand, 21579228 - 21579154
Alignment:
| Q |
164 |
aacattagaatcattactagatacctctcgaggatatcagtgcattgtgtttatccctttagcacacttaaatac |
238 |
Q |
| |
|
||||||||||||||||||| || ||||| |||||||| |||| |||||||| ||||||||||||||||| |||| |
|
|
| T |
21579228 |
aacattagaatcattactaaattcctcttgaggatataagtgtgttgtgtttgtccctttagcacacttagatac |
21579154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University