View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20117_low_14 (Length: 240)
Name: NF20117_low_14
Description: NF20117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20117_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 9e-91; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 177
Target Start/End: Original strand, 2489165 - 2489341
Alignment:
| Q |
1 |
atgaaagtaattacataaagtagctgatggaaaaaagataacacaaaatttcaatttctgaaccacatattaatatgttctcactaaaccacatgttaat |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2489165 |
atgaaagtagttacataaagtagctgatgaaaaaaagataacacaaaatttcaatttctgaaccacatattaatatgttctcactaaaccacatgttaat |
2489264 |
T |
|
| Q |
101 |
atgttgacagatagagttaaagttttgttctctaaagttaataaacaatactgctgcagcaacacaccgaattttct |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2489265 |
atgttgacagatagagttaaagttttgttctctaaagttaataaacaatactgctgcagcaacacaccgaattttct |
2489341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 17 - 77
Target Start/End: Original strand, 2524269 - 2524329
Alignment:
| Q |
17 |
aaagtagctgatggaaaaaagataacacaaaatttcaatttctgaaccacatattaatatg |
77 |
Q |
| |
|
||||||||| || |||||||||||| ||||||||||||| || |||||||||||| |||| |
|
|
| T |
2524269 |
aaagtagctaatccaaaaaagataacccaaaatttcaattactaaaccacatattactatg |
2524329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 197 - 225
Target Start/End: Original strand, 2489358 - 2489386
Alignment:
| Q |
197 |
ttggaaggtaaaagaagatgagtgcaaag |
225 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2489358 |
ttggaaggtaaaagaagatgagtgcaaag |
2489386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University