View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20118_high_34 (Length: 298)
Name: NF20118_high_34
Description: NF20118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20118_high_34 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 45302914 - 45303163
Alignment:
| Q |
1 |
caactaagaatctttttagttgagtgagtatggtggtttgaactttgaagcaatgtttaggttgttgcctttccttagtgccagccttcagctctaacgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
45302914 |
caactaagaatctttttagttgagtgagtatggtggtttgaactttgaagcaatgtttaggttgttgcctttccttagtgccagccttcagctctaatgt |
45303013 |
T |
|
| Q |
101 |
cagtgtaaaaaatttaaaccgtcaatatatcaggaatatacatgtgtgaatttgtaatcccttatgaggaaagtctagataattccttgttagtacaaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45303014 |
cagtgtaaaaaatttaaaccgtcaatatatcaggaatatacatgtgtgaatttgtaatcccttatgaggaaagtctagataattccttgttagtacaaaa |
45303113 |
T |
|
| Q |
201 |
aatcataacattaacaatgtgtatatattaagggcaattatataattgaa |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45303114 |
aatcataacattaacaatgtgtatatattaagggcaattatatatttgaa |
45303163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University