View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20118_high_41 (Length: 237)
Name: NF20118_high_41
Description: NF20118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20118_high_41 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 5027430 - 5027544
Alignment:
| Q |
1 |
tttacgttgatcatggtggtgatgtgaaattggtgagttatgatattgtggggttttttagggatggagggtttttggatggggttgaagaggtggatga |
100 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5027430 |
tttacgttgatcatagtggtgatgtgagattggtgggttatgatattgtggggttttttagggatggagggtttttggatggggttgaagaggtggatga |
5027529 |
T |
|
| Q |
101 |
tccggtttgggcggc |
115 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
5027530 |
tccggtttgggcggc |
5027544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University