View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20118_low_17 (Length: 427)
Name: NF20118_low_17
Description: NF20118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20118_low_17 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 111; Significance: 7e-56; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 111; E-Value: 7e-56
Query Start/End: Original strand, 233 - 351
Target Start/End: Complemental strand, 7195455 - 7195337
Alignment:
| Q |
233 |
tatatattaagtatattaacacttttgtatggaagaaacatgttgtgcctcgtgcattctttcaatagtgattaactattttttcttttgatttgggggg |
332 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7195455 |
tatatattaagtatagtaacacttttgtatggaagaaacatgttgtgcctcgtgcattctttcaatagtgattaactattttttcttttgatttgggggg |
7195356 |
T |
 |
| Q |
333 |
taagccacatcattggtgg |
351 |
Q |
| |
|
||| ||||||||||||||| |
|
|
| T |
7195355 |
taacccacatcattggtgg |
7195337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 122 - 241
Target Start/End: Complemental strand, 7195891 - 7195772
Alignment:
| Q |
122 |
tatgagttggtatatctgcaccattttaatttcttgagtccattattaagactccatgcatagtttaaattgacttgctcaaaatatatatggttgatat |
221 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7195891 |
tatgatttggtatatgtgcaccattttaatttcttgagtccattattaagacttcatgcatagtttaaattgacttgctcaaaatatatatggttgatat |
7195792 |
T |
 |
| Q |
222 |
ttaaacatgcatatatatta |
241 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
7195791 |
ttaaacatgcatatatatta |
7195772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 365 - 427
Target Start/End: Complemental strand, 48214360 - 48214298
Alignment:
| Q |
365 |
ctgaaacatattttatagttagcacatataaagatctcagacacaaaatcaacataaacgtat |
427 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
48214360 |
ctgaaacatattttatagttaacacacataaagatctcaaacacaaaatcaccataaacgtat |
48214298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University