View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20119_low_13 (Length: 243)
Name: NF20119_low_13
Description: NF20119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20119_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 36 - 221
Target Start/End: Complemental strand, 39884268 - 39884083
Alignment:
| Q |
36 |
caacctcgattggtggatttcggaggaatttaaaacaacaacttaccgtgaattacagtgtatgatatttcnnnnnnnnttgcactttgatattgtgatt |
135 |
Q |
| |
|
||||||| ||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39884268 |
caacctccattggtggattgcggaagaatttaaaacaacaacttaccgtgaattacagtgtatgatatttcaaaaaaaattgcactttgatattgtgatt |
39884169 |
T |
 |
| Q |
136 |
tttgtcaaattcaccttaactccaaaaaagcaggtaaatgttatacaaagagaatggattctatctttcatatggattgtcatata |
221 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39884168 |
tttgtcaaagtcaccttaactccaaaaaagcaggtaaatgttatacaaagagaatggattctatctttcatatggattgtcatata |
39884083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University