View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2011_high_11 (Length: 251)
Name: NF2011_high_11
Description: NF2011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2011_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 31784897 - 31784667
Alignment:
| Q |
1 |
aaggttttggttctcagttgagacatgttcaaagttttcatcatctgtttgtttctgttcattctcttcagctggaagattctaatctaaaagccggttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31784897 |
aaggttttggttctcagttgagacatgttcaaagtttccatcatctgtctgtttctgttcattctcttcagctggaagattcaaatctaaaagccggttt |
31784798 |
T |
 |
| Q |
101 |
gatgttgtatgcgcctttttagccgtatctgcaagtaaatagggatcatgaagttcattgtcaccaatcaattttcgtttgtttatgaaatttagattag |
200 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||| ||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31784797 |
gatgttgtatgtgcccttttagccgcatctgcgagtaaatggggatcgtgaagttcattgtcaccaatcaattttcgtttgtttatgaaatttagattag |
31784698 |
T |
 |
| Q |
201 |
gaatgacatttattgaattgttagctacacc |
231 |
Q |
| |
|
|||||| |||||||||||||||| |||||| |
|
|
| T |
31784697 |
gaatgatgtttattgaattgttaggtacacc |
31784667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 143 - 231
Target Start/End: Original strand, 19631618 - 19631706
Alignment:
| Q |
143 |
ggatcatgaagttcattgtcaccaatcaattttcgtttgtttatgaaatttagattaggaatgacatttattgaattgttagctacacc |
231 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19631618 |
ggatcgtgaagttcattgtcaccaatcaattttcgtttgtttatgaaatttagattaggaatgacatttattgaattgttagctacacc |
19631706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University