View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2011_low_11 (Length: 297)
Name: NF2011_low_11
Description: NF2011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2011_low_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 99 - 213
Target Start/End: Original strand, 2223015 - 2223129
Alignment:
| Q |
99 |
ttttgttgtgttgaagaatatcatcattttcttccatttcatctttggagtagttgttgtaattggttctaatgattttgattccttttttgtacttccc |
198 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| | || ||| |
|
|
| T |
2223015 |
ttttgttgtgttgaagaaaatcatcattttcttccatttcatctttggagtagtagttgcaattggttctaatgattttgattcctttttggaaccaccc |
2223114 |
T |
 |
| Q |
199 |
catttcttgtctgtg |
213 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
2223115 |
catttcttgtttgtg |
2223129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University