View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2011_low_11 (Length: 297)

Name: NF2011_low_11
Description: NF2011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2011_low_11
NF2011_low_11
[»] chr6 (1 HSPs)
chr6 (99-213)||(2223015-2223129)


Alignment Details
Target: chr6 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 99 - 213
Target Start/End: Original strand, 2223015 - 2223129
Alignment:
99 ttttgttgtgttgaagaatatcatcattttcttccatttcatctttggagtagttgttgtaattggttctaatgattttgattccttttttgtacttccc 198  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| | ||  |||    
2223015 ttttgttgtgttgaagaaaatcatcattttcttccatttcatctttggagtagtagttgcaattggttctaatgattttgattcctttttggaaccaccc 2223114  T
199 catttcttgtctgtg 213  Q
    |||||||||| ||||    
2223115 catttcttgtttgtg 2223129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University