View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2011_low_16 (Length: 207)

Name: NF2011_low_16
Description: NF2011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2011_low_16
NF2011_low_16
[»] chr2 (2 HSPs)
chr2 (83-207)||(45063246-45063370)
chr2 (99-135)||(3505067-3505103)


Alignment Details
Target: chr2 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 83 - 207
Target Start/End: Complemental strand, 45063370 - 45063246
Alignment:
83 agacattaaaacgtaaatgtctaaaccatatgtgtcattataactgttctaaatgagacaaccaccatcgttagtcaagcatccatcaatatcagtgatg 182  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
45063370 agacattaaaacgtaaatgtctaaaccacatgtgtcattataactgttctaaatgagacaaccaccatcgttagtcaagcatccaccaatatcagtgatg 45063271  T
183 aggaaaagaacttggtaacctcttc 207  Q
    |||||||||||| ||||||||||||    
45063270 aggaaaagaactgggtaacctcttc 45063246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 99 - 135
Target Start/End: Complemental strand, 3505103 - 3505067
Alignment:
99 atgtctaaaccatatgtgtcattataactgttctaaa 135  Q
    |||||||| |||||||||||||||||| |||||||||    
3505103 atgtctaacccatatgtgtcattataattgttctaaa 3505067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University