View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20120_high_13 (Length: 254)
Name: NF20120_high_13
Description: NF20120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20120_high_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 2385473 - 2385723
Alignment:
| Q |
1 |
attttcaaaaagcaataaggtttatacata----gaaagataatatagttgtaagatgtgtagtatactaaagtaaaatattcaagacagattgtttccg |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||||||||||||||||| ||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
2385473 |
attttcaaaaagcaataaggtttatacatacatagaaggataatatagttgtaagatc-gtagtatacgaaagtaaaatattcaagacagcttgtttccg |
2385571 |
T |
|
| Q |
97 |
attatgtaatcatttcgttaatttgatcttgccgcatcatcctataggcatgagtttcgaacttgcttgtcatgcattaatactcttcacagaacagtat |
196 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||| |||||||||||||||| |||||| | |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2385572 |
attaagtaatcatttcgtcaatttgatcttgccgaatcatcctataggcattagtttccaccttgcttgtcatgcattaatactcttcacataacagtat |
2385671 |
T |
|
| Q |
197 |
tcaaatatagaaaataatcatccctctagagaaaaacaaaagatattcttcg |
248 |
Q |
| |
|
||||||||||||||| |||| ||||| ||||| |||||||||||||| |||| |
|
|
| T |
2385672 |
tcaaatatagaaaatgatcagccctccagagagaaacaaaagatatttttcg |
2385723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University