View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20120_high_18 (Length: 244)
Name: NF20120_high_18
Description: NF20120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20120_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 235
Target Start/End: Complemental strand, 14811173 - 14810956
Alignment:
| Q |
18 |
tttggatcctttgtttttattttctcttcccttaagcttttggctctgtgattttaggttatgtttacgttgagggtgttgatgatataaccatggtgtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
14811173 |
tttggatcctttgtttttattttctcttcccttaaggttttggttctgtgattttaggttatgtttacattgagggtgtcgatgatataaccatggtgtt |
14811074 |
T |
 |
| Q |
118 |
atttaatccccccatcgctgaatacgttcagtttaagaataggtttgcttaactctttcatgaggttttggatatttgcagtttacttagtttatgtcgt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14811073 |
atttaatccccccatcgctgaatacgttcggtttaagaataggtttgcttaactctttcatgaggttttggatatttgcagtttacttagtttatgtcgt |
14810974 |
T |
 |
| Q |
218 |
aggttaatttcatctttg |
235 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
14810973 |
aggttaatttcatctttg |
14810956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University