View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20120_high_19 (Length: 240)
Name: NF20120_high_19
Description: NF20120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20120_high_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 9e-91; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 6 - 222
Target Start/End: Original strand, 12394918 - 12395134
Alignment:
| Q |
6 |
ataacaccaaacagaggagttagtcataactcggaccagataaaatgaaattcaaatatttgcacacgttagaaatttgagaatcgggatgattggagta |
105 |
Q |
| |
|
||||||||||||||| || ||||| |||| | ||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
12394918 |
ataacaccaaacagacgatttagtaataatttggaccagataaaatggaattcaaatatttgcacacattagaaatttgagaatcgggatgattggagta |
12395017 |
T |
 |
| Q |
106 |
gttcgtgaggaatgtgattacagttttaccaagttcgtgagaaccaagcatagttttaatggcatttgcttttgtagcatcaaatggtacatctagcttg |
205 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
12395018 |
gttcatgaggaatgtgattacagctttaccaagttcgcgagaaccaagcatagttgtaatggcatttgcttttgtagcatcaaatggtatatctagcttg |
12395117 |
T |
 |
| Q |
206 |
ttgcttgggtcaaatct |
222 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
12395118 |
ttgcttgggtcaaatct |
12395134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 111 - 192
Target Start/End: Original strand, 12356114 - 12356195
Alignment:
| Q |
111 |
tgaggaatgtgattacagttttaccaagttcgtgagaaccaagcatagttttaatggcatttgcttttgtagcatcaaatgg |
192 |
Q |
| |
|
|||||||||| ||||||||||||| ||| || ||| ||||||||||| | || | |||||||||||| ||||||||||| |
|
|
| T |
12356114 |
tgaggaatgtaattacagttttacaaagatcacaagagccaagcatagtggttatcgaatttgcttttgtggcatcaaatgg |
12356195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University