View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20120_high_25 (Length: 219)
Name: NF20120_high_25
Description: NF20120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20120_high_25 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 17 - 202
Target Start/End: Complemental strand, 13540746 - 13540561
Alignment:
| Q |
17 |
attttatttgtctatttctttgtttgattatcttattataagaattgaaactcactgagatacaattgctctttgtagtggattgaagaataatgattgc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13540746 |
attttatttgtctatttctttgtttgattatcttattataagaattgaaactcaccgagatacaattgctctttgtagtggattgaagaataatgattgc |
13540647 |
T |
 |
| Q |
117 |
ataaaagcgaaatatcattaccgaaaagcaaaagttgatggcgttatatatgaactcaacgataatgcttatgttcaggtttgtat |
202 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13540646 |
ataaaagcgaagtatcattaccgaaaagcaaaagttgatggcgttatatatgaactcaacgataatgcttatgttcaggtttgtat |
13540561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University