View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20120_high_9 (Length: 282)
Name: NF20120_high_9
Description: NF20120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20120_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 275
Target Start/End: Original strand, 52630674 - 52630934
Alignment:
| Q |
18 |
aacatgtatccataattcaccaccccaaacatccacatacatttctttctcccaaattagaggacccttaattcctacacctccttttcccatttcaatc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52630674 |
aacatgtatccataattcaccaccccaaacatccacatacatttctttctcccaaactagaggacccttaattcctacacctccttttcccatttcaatc |
52630773 |
T |
 |
| Q |
118 |
accactcctttcatccctgtatctgcttgtccgtttattgagtgtccgtgtcctctcgctgacaccgcaa---actgctgccatttatacgccgctttaa |
214 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
52630774 |
accactcctttcatccttgtatccgcttgtccgtttattgagtgtccgtgtcctctcgctgacaccgcaaagtactgctgccatttatacgccgctttaa |
52630873 |
T |
 |
| Q |
215 |
cttcccttgccacgtcattggccgacgctggtcgaaccaccgcaatcgtccctcctttgct |
275 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
52630874 |
ctacccttgccacgtcattggccgacgctggtcgaaccaccgcaatcgtctctcctttgct |
52630934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University