View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20120_low_10 (Length: 301)
Name: NF20120_low_10
Description: NF20120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20120_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 18 - 285
Target Start/End: Original strand, 3445323 - 3445589
Alignment:
| Q |
18 |
ggtttatgtcattttaatctttcttgttgtcttctgagtttagatgcatcatcatcacaaatttgcagtaggattcacgtgaatcagataatattattaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3445323 |
ggtttatgtcattttaatctttcttgttgtcttttgagtttagatacatcatcatcacaaatttgcagtaggattcacgtgaatcagataatattattaa |
3445422 |
T |
|
| Q |
118 |
tgttttagatatggtttttgttatgatgtatcttatcaacatgatgttgcatgtgtggattatgtcacaaaacatcctttgccatctctttcatgaatct |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3445423 |
tgttttagatatggtttttgttatgatgtatgttatcaacatgatgttgcatgtgt-gattatgtcacaaaacatcctttgccatctctttcatgaatct |
3445521 |
T |
|
| Q |
218 |
ggtttgtgaaggattcttaatgttctttgaatctctgatggatgcaatttggaagagaaaaatgagaa |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3445522 |
ggtttgtgaaggattcttaatgttctttgaatctctgatggatgcaatttggaagagaaaaatgagaa |
3445589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University