View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20120_low_20 (Length: 249)
Name: NF20120_low_20
Description: NF20120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20120_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 5414588 - 5414355
Alignment:
| Q |
1 |
gtcttctattttgctcatcaatggaaccttgcaaaggagaatacatggacttattggtgctttcttcaagtctcaacagttaaaggttcagattacctca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5414588 |
gtcttctattttgctcatcaatggaaccttgcaaaggagaatacatggacttattggtgctttcttcaagtctcaacagttaaaggttcagattacctca |
5414489 |
T |
 |
| Q |
101 |
gatatgcagaagtatgtacaagaatcaatggcaaattggaaagaggaccaacctatatacatacaagatgaaacaaaaaaggttacctctctttccttcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5414488 |
gatatgcagaagtatgtacaagaatcaatggcaaattggaaagaggaccaacctatatacatacaagatgaaacaaaaaaggttacctctgtttccttcc |
5414389 |
T |
 |
| Q |
201 |
ccctcagtttctgagtgtgtgtgagtttgtacta |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
5414388 |
ccctcagtttctgagtgtgtgtgagtttgtacta |
5414355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 158 - 202
Target Start/End: Complemental strand, 14087728 - 14087684
Alignment:
| Q |
158 |
tacatacaagatgaaacaaaaaaggttacctctctttccttcccc |
202 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
14087728 |
tacatacaagatgaaacaaaaaaggctacctctttttccttcccc |
14087684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University