View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20120_low_30 (Length: 219)
Name: NF20120_low_30
Description: NF20120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20120_low_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 35 - 177
Target Start/End: Complemental strand, 43472075 - 43471933
Alignment:
| Q |
35 |
tcacaaatttcacttcactgaaacaataacaataatcacaacaattagtgaagaattaatcttgattgagaaaagaagctgaaattaattgagtttcaga |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
43472075 |
tcacaaatttcacttcactgaaacaataacaataatcacaacaattagtgaagaattaatcttgattaagaaaagaagctgaatttaattgagtttcaga |
43471976 |
T |
 |
| Q |
135 |
tcccagaaacggcgcgagggactgtgagatgaatctctgaaac |
177 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43471975 |
tcccaaaaacggcgcgagggactgtgagatgaatctctgaaac |
43471933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University