View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20121_low_6 (Length: 253)
Name: NF20121_low_6
Description: NF20121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20121_low_6 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 149 - 253
Target Start/End: Original strand, 11102878 - 11102982
Alignment:
| Q |
149 |
gatgaaagatacatattgaactaaactacaagatacaaaaatactcacctctatttaggcacacatttatacataacattaaaatctatattaattaatt |
248 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11102878 |
gatgaaagatacatattcaactaaactacaagatacaaaaatactcacctctatttaggcacacatttatacctaacattaaaatctatattaattaatt |
11102977 |
T |
 |
| Q |
249 |
aatta |
253 |
Q |
| |
|
||||| |
|
|
| T |
11102978 |
aatta |
11102982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 11102747 - 11102805
Alignment:
| Q |
19 |
atttaggggcaaattctaa-atattctagagtttgattgagtaccgatgtcttataagc |
76 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
11102747 |
atttaggggcaaattcttagatattctagagtttgattgagtaccgatatcctataagc |
11102805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University