View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20122_high_10 (Length: 270)
Name: NF20122_high_10
Description: NF20122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20122_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 92; Significance: 9e-45; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 163 - 254
Target Start/End: Original strand, 25814482 - 25814573
Alignment:
| Q |
163 |
aagttttgtctacaaatacatgtacccaacaaaatttcagggtgcgtaagaatttatttgtttctaaaccttgtgtcgcctacctttttact |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25814482 |
aagttttgtctacaaatacatgtacccaacaaaatttcagggtgcgtaagaatttatttgtttctaaaccttgtgtcgcctacctttttact |
25814573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University