View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20122_high_11 (Length: 256)
Name: NF20122_high_11
Description: NF20122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20122_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 139 - 251
Target Start/End: Complemental strand, 2930898 - 2930786
Alignment:
| Q |
139 |
gagaaacaatagtagataaaatacatgctatctattgcccatgatccctgatcgttcctgttattgtagtaaatcgaatgcatccggatgcattagaaaa |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2930898 |
gagaaacaatagtagataaaatacatgctatctattgcccatgatccccgatcgttcctgttattgtagtaaatcgaatgcatccggatgcattagaaaa |
2930799 |
T |
 |
| Q |
239 |
atcaatcattttc |
251 |
Q |
| |
|
||||||||||||| |
|
|
| T |
2930798 |
atcaatcattttc |
2930786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 17 - 70
Target Start/End: Complemental strand, 2937259 - 2937206
Alignment:
| Q |
17 |
taaacatccattaactactagtgttttttcattgcaagagaatttttcttcatt |
70 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||||||||||| ||||||| |
|
|
| T |
2937259 |
taaacatccattaactactagtttttcttcattgcaagagaattttacttcatt |
2937206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University