View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20122_high_5 (Length: 338)
Name: NF20122_high_5
Description: NF20122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20122_high_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 20 - 321
Target Start/End: Complemental strand, 22047238 - 22046939
Alignment:
| Q |
20 |
gcagccatatggagagttcgacactaaatttgttaaagaacattattatgagcttggtctaagattaactatcatcgataggagaggcaacacaaaggat |
119 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||| |
|
|
| T |
22047238 |
gcagccatatggagagttcgaccctaaatttgttaaagaacattattatgagcttggtctaagattaactatcatcgataggagaggcaacata--ggat |
22047141 |
T |
|
| Q |
120 |
gtcgatttcaacttaagttttcattttcctctaatcactaaaggatggactgaattgagacaattatttggaattaatggtaacaaacttcttttaatga |
219 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22047140 |
gtggatttcaacttaagttttcattttcctctaatcactaaaggatggactgaattgagacaattatttggaattaatggtaacaaacttcttttaatga |
22047041 |
T |
|
| Q |
220 |
cataccttggtgacaatcattttgcccttgatgtccagccagatgaattcaccccattgaagttaccatattatcatacatattgatatattggacttga |
319 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
22047040 |
cataccttggtgacaatcgttttggccttgatgtccagctagatgaattcagcccattgaagttaccatattatcatacatatcgatatattggacttga |
22046941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University