View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20122_low_12 (Length: 288)
Name: NF20122_low_12
Description: NF20122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20122_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 65 - 280
Target Start/End: Original strand, 4702586 - 4702801
Alignment:
| Q |
65 |
aggtttgttgctttgctaatttttgttgttgtgaataatttgttaaatcatacgatgccctatgaattattaaagtgatgcccttctgagtatgtatact |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4702586 |
aggtttgttgctttgctaatttttgttgttgtgaataatttgttaaatcataagatgccgtatgaagtattaaagtgatgcccttctgagtatgtatact |
4702685 |
T |
|
| Q |
165 |
tactgaacctatttgcattgtttagtgcaacaaagcggaatagcaagatgtcagaggcagattctgccatatgcaaaaagaaaaggaatggagagtggtc |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4702686 |
tactgaacctatttgcattgtttagtgcaacaaagcggaatagcaagatgtcagaggctgattctgccatatgcaaaaagaaaaggaatggagagtggtc |
4702785 |
T |
|
| Q |
265 |
aaatatgccctatgat |
280 |
Q |
| |
|
||||||||| |||||| |
|
|
| T |
4702786 |
aaatatgccttatgat |
4702801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 153 - 247
Target Start/End: Original strand, 4706046 - 4706141
Alignment:
| Q |
153 |
agtatgtatacttactgaacct-atttgcattgtttagtgcaacaaagcggaatagcaagatgtcagaggcagattctgccatatgcaaaaagaaa |
247 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||| ||||||| |||||| ||||||||| |||| ||||||||||| ||||||| |||| |
|
|
| T |
4706046 |
agtatgtatacttactgaaccttatttacattgtttagttaaacaaagtggaataccaagatgtcggaggttgattctgccatctgcaaaatgaaa |
4706141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 4702552 - 4702590
Alignment:
| Q |
1 |
tgattttgctattacttcttttatttacagactaaggtt |
39 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4702552 |
tgattttgctattgcttcttttatttacagactaaggtt |
4702590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University