View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20122_low_15 (Length: 270)

Name: NF20122_low_15
Description: NF20122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20122_low_15
NF20122_low_15
[»] chr1 (1 HSPs)
chr1 (163-254)||(25814482-25814573)


Alignment Details
Target: chr1 (Bit Score: 92; Significance: 9e-45; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 163 - 254
Target Start/End: Original strand, 25814482 - 25814573
Alignment:
163 aagttttgtctacaaatacatgtacccaacaaaatttcagggtgcgtaagaatttatttgtttctaaaccttgtgtcgcctacctttttact 254  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25814482 aagttttgtctacaaatacatgtacccaacaaaatttcagggtgcgtaagaatttatttgtttctaaaccttgtgtcgcctacctttttact 25814573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University