View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20122_low_16 (Length: 256)

Name: NF20122_low_16
Description: NF20122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20122_low_16
NF20122_low_16
[»] chr1 (2 HSPs)
chr1 (139-251)||(2930786-2930898)
chr1 (17-70)||(2937206-2937259)


Alignment Details
Target: chr1 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 139 - 251
Target Start/End: Complemental strand, 2930898 - 2930786
Alignment:
139 gagaaacaatagtagataaaatacatgctatctattgcccatgatccctgatcgttcctgttattgtagtaaatcgaatgcatccggatgcattagaaaa 238  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
2930898 gagaaacaatagtagataaaatacatgctatctattgcccatgatccccgatcgttcctgttattgtagtaaatcgaatgcatccggatgcattagaaaa 2930799  T
239 atcaatcattttc 251  Q
    |||||||||||||    
2930798 atcaatcattttc 2930786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 17 - 70
Target Start/End: Complemental strand, 2937259 - 2937206
Alignment:
17 taaacatccattaactactagtgttttttcattgcaagagaatttttcttcatt 70  Q
    |||||||||||||||||||||| ||| ||||||||||||||||||| |||||||    
2937259 taaacatccattaactactagtttttcttcattgcaagagaattttacttcatt 2937206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University